pentr223 plxnb2  (Addgene inc)

Journal: bioRxiv

Article Title: Structure and mechanism of the human TMEM260 O-mannosyltransferase

doi: 10.64898/2026.03.17.711096

Figure Lengend Snippet: a , Domain organization of the TMEM260 substrate PLXNB2, highlighting IPT domains containing reported O-mannosylation sites. The AlphaFold-predicted structure of the PLXNB2-IPT1 domain is shown in pink with annotated β-strands. The T822 glycosylation site and characteristic IPT-domain prolines within the A-B strand region are indicated. b , MALDI-TOF analysis of peptide pulldowns using beads decorated with TMEM260 luminal truncations (Rl-TPR or TPR-only). The TPR region is necessary and sufficient for recruitment of the PLXNB2-IPT1 peptide. c , Schematic (top left) of the sfGFP-PLXNB2-IPT1 reporter assay used to assess TMEM260-catalyzed glycosylation in cells. Glycoproteomic analysis of T822 glycosite shows robust O-mannosylation in WT cells and in COSMC/POMGNT1 KO “SimpleCells” used as glycoengineering control, whereas O-mannose transfer to the sfGFP-PLXNB2-IPT1 reporter is abolished in HEK293 TMEM260 KO and HEK293 TMEM260 KO D52A KI cells (right). Model (bottom left) summarizing the experimental findings. In WT cells, the reporter enters the ER lumen, where the extended C-terminal peptide is recruited by TMEM260 and the T822 is O-mannosylated. In the absence of TMEM260 activity, the ER-resident O-mannosyltransferases TMTC1–4 or POMT1/2 enzymes do not act on the sfGFP-PLXNB2-IPT1 reporter.

Article Snippet: The coding region for PLXNB2 (803-837) was amplified from pENTR223-PLXNB2 (Addgene plasmid #86236; gift from Roland Friedel; RRID:Addgene_86236) and RON (684-715) from pDONR223-MST1R (Addgene plasmid #23942; gift from William Hahn & David Root; RRID:Addgene_23942).

Techniques: Glycoproteomics, Reporter Assay, Control, Activity Assay

Journal: bioRxiv

Article Title: Structure and mechanism of the human TMEM260 O-mannosyltransferase

doi: 10.64898/2026.03.17.711096

Figure Lengend Snippet: a , Cryo-EM density map of TMEM260 in complex with the native donor Dol-P-Man and a PLXNB2-IPT1-derived acceptor peptide, determined at 3.1 Å resolution. Major structural regions are indicated and colored consistently throughout the figure. The top-right panel shows a view from the ER lumen, perpendicular to the membrane, with the acceptor peptide shown as a ribbon, the T822 glycosylation site highlighted and Dol-P-Man shown as sticks. This orientation emphasizes insertion of the N terminus into the finger region and positioning of the glycosylation site within the catalytic pocket. b , Front view of the corresponding atomic model in ribbon representation. Close-up (dashed circle) highlights the Dol-P-Man density and fitted model. c , Close-up of the ER-luminal region of TMEM260 shown in surface representation and colored by electrostatic potential, with the bound peptide as a ribbon and side chains as sticks. Dol-P-Man is shown as sticks and the T822 glycosylation site is indicated. d , Same view as in c , shown in ribbon representation to highlight specific interactions between TMEM260 residues and the acceptor peptide. The T822 glycosylation site is indicated. e , Sequence alignment of the PLXNB2-IPT1 peptide with reported O-mannosylated IPT domains from plexin, cMET and RON receptors, highlighting conserved residues proposed to define a TMEM260-specific acceptor sequon. f , Close-up of the active-site environment showing superposition of Dol-P-Man in the binary complex (all in grey including Dol-P-Man) and in the ternary complex (all in color with acceptor peptide in yellow and Dol-P-Man in black) with the PLXNB2-IPT1 peptide. In the ternary complex, the β-mannose moiety undergoes an approximately 60° rotation, indicating a peptide-induced reorientation of the donor sugar.

Article Snippet: The coding region for PLXNB2 (803-837) was amplified from pENTR223-PLXNB2 (Addgene plasmid #86236; gift from Roland Friedel; RRID:Addgene_86236) and RON (684-715) from pDONR223-MST1R (Addgene plasmid #23942; gift from William Hahn & David Root; RRID:Addgene_23942).

Techniques: Cryo-EM Sample Prep, Derivative Assay, Membrane, Glycoproteomics, Sequencing

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) IF showing loss of Plexin-B2 protein in PLXNB2 ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Two Tailed Test, Knock-Out, Expressing, Live Cell Imaging, Labeling

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) UMAP embedding of snRNA-seq data from D9 cells (n = 3 replicates per genotype). WT cells segregated into clusters enriched for radial glia (RG), neural progenitors (NPCs), and ESC-like states, whereas KO cells aligned with differentiated neuronal clusters. b) Feature plots showing expression of NPC and neuronal markers. c) Expression of representative marker genes across D9 subclusters. d) Volcano plot of differentially expressed genes (DEGs; PLXNB2 -/- vs. WT), with selected genes highlighted. e) Bubble plot of enriched pathways upregulated in D9 PLXNB2 ⁻/⁻ cells. f) ENRICHR GO enrichment analysis of DEGs for categories of biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Violin plots showing downregulation of actin cytoskeleton–associated genes in PLXNB2 -/- cells. h) Heatmap of DEGs grouped by functional categories, across three replicates per genotype. i) Ingenuity Pathway Analysis (IPA) network summary. Growth factor signaling pathways were broadly suppressed, while PTEN was activated in PLXNB2 ⁻/⁻ cells. j) Predicted upstream regulators (IPA) of DEGs in PLXNB2 ⁻/⁻ vs. WT cells. k) Developmental stage scoring against human cortex gene signatures (Velmeshev et al., 2023). D9 WT cells aligned with 2 nd -3 rd trimester profiles, whereas PLXNB2 ⁻/⁻ cells shifted toward postnatal signatures.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Expressing, Marker, Functional Assay, Protein-Protein interactions

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) Workflow for generating anti-Plexin-B2 (PB2) nanobodies (Nbs). Camelids were immunized with recombinant extracellular domain of human PB2 protein, followed by phage display to isolate high-affinity VHHs, which were fused to human Fc (hFc). b) Experimental design. VHH-Fc Nbs (10 μg/ml) were added one day before iN protocol. c) Representative images showing reduced cortical F-actin, increased DCX and TUJ1, and decreased SOX2 in D10 cells treated with two independent anti-PB2 Nbs compared with control or no Nb. d) Quantification of marker expression. Each dot represents the mean of a field of view. n = 5 cultures for each condition; one-way ANOVA with Dunnett’s multiple-comparison test. Bar graphs represent mean ± SEM.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Recombinant, Control, Marker, Expressing, Comparison

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) Standard forebrain and midbrain neuronal differentiation protocols. At D36, WT cells generated dense networks of TUJ1⁺ axon-bearing neurons, whereas PLXNB2 ⁻/⁻ cells displayed aberrant morphologies. b) Accelerated protocol. After passage at D9, cells were switched directly to maturation medium, bypassing the differentiation media step. By D18a, PLXNB2 ⁻/⁻ cells developed dense networks of TUJ1⁺ axon-bearing neurons, while WT cells retained progenitor-like morphology. c) IF comparison of neuronal markers and morphology in D36 WT (standard protocol) and D18a PLXNB2 ⁻/⁻ (accelerated protocol) cells. d) UMAP embedding of D18a PLXNB2⁻/⁻ and D36 WT iNs, showing segregation by genotype and forebrain vs. midbrain protocols. e) Feature plots showing shared neuronal markers across subclusters and genotypes. f) Transcriptional profiling revealed comparable expression of core neuronal/axonal markers between D36 WT and D18a PLXNB2 ⁻/⁻ cells, but lower expression of functional genes in the latter. g) Experimental timeline and IF images show co-culture of iNs with GFAP⁺ astrocyte lawns to promote maturation. h) Multi-electrode array (MEA) recordings. PLXNB2 ⁻/⁻ cells after maturation exhibited higher firing rates and synchrony index than WT cells (n = 6 cultures per condition; one-way ANOVA with Dunnett’s correction). Bar graphs represent mean ± SEM. i) Heatmap of epigenetic regulators shows convergent transcriptional shifts of D36 WT and D18a PLXNB2 ⁻/⁻ iNs relative to D9 WT cells. D9 PLXNB2 ⁻/⁻ cells already exhibited a similar shift, indicating accelerated epigenetic reprogramming. j) D9 PLXNB2 ⁻/⁻ cells showed elevated nuclear TET3 compared with D9 WT, reaching levels comparable to D36 WT. n = 5 fields from 2 independent experiments for each condition, nested one-way ANOVA with Tukey’s multiple-comparison test. k) D9 PLXNB2 ⁻/⁻ cells exhibited precocious expression of lamin A/C, similar to D36 WT and D18a PLXNB2 ⁻/⁻ iNs. l) Working model: Plexin-B2-mediated cortical tension act as a mechanical barrier alongside an epigenetic barrier to prevent precocious differentiation.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Generated, Comparison, Expressing, Functional Assay, Co-Culture Assay

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) IF of day 42 cerebral organoids shows broad Plexin-B2 expression in the ventricular zone (VZ; SOX2⁺) and cortical plate (CP), including FAM107A⁺ outer radial glia. b) IF of human fetal brain at 23 gestational weeks reveals broad Plexin-B2 expression in the SOX2⁺ germinal matrix and developing cortex, including FAM107A⁺ cells. c) Representative images and quantification of organoid diameters show reduced size in PLXNB2 ⁻/⁻ organoids (WT, n = 15; KO, n = 16). Bar graphs represent mean ± SEM; unpaired two-tailed Student’s t-test. d) Left, IF demonstrates loss of Plexin-B2 in d42 KO organoids. Right, Western blot confirms Plexin-B2 ablation, with β-actin as loading control. Quantification from n = 3 independent experiments. unpaired two-tailed Student’s t -test. e) Left, IF reveals disrupted architecture of KO organoids with shrinkage of SOX2 + VZ. Right, Western blot and heatmap show reduced SOX2 and increased TUJ1. n = 3 independent cultures per condition; unpaired two-tailed Student’s t-test. f) KO organoids exhibit expanded but disorganized DCX⁺ neuroblasts and reduced PAX6⁺ progenitors. g) Disrupted neuroepithelial organization in KO organoids, with diffuse β-catenin, N-cadherin, and reduced apical F-actin enrichment. h) WT organoids contain a dense apical ring of proliferating Ki67⁺/pH3⁺ cells, which was reduced and mislocalized in KO organoids. i) EdU pulse-chase assay design (30 min pulse, 24 h chase). KO organoids showed increased cell-cycle exit (i.e. fraction of Ki67⁻ cells among EdU⁺ cells). n = 6 fields from 3 independent organoids for each condition; unpaired two-tailed t-test. j) Model: Plexin-B2 maintains progenitor pool homeostasis by regulating the timing of neuronal differentiation. Loss of Plexin-B2 leads to premature cell-cycle exit, precocious neuronal differentiation, and progenitor depletion.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Expressing, Two Tailed Test, Western Blot, Control, Pulse Chase

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) UMAP embedding of snRNA-seq profiles from day 42 cerebral organoids (n = 3 replicates per genotype). EN, excitatory neurons; Mes, mesenchymal-like; Epen, ependymal-like; SCP, Schwann cell precursor/neural crest-like. b) Stacked bar plots show loss of RG (sc0) and expansion of subplate-like (sc3) and maturing EN (sc6) populations in PLXNB2 ⁻/⁻ organoids, reflecting accelerated neurogenesis and lineage imbalance. c) Dot plot showing expression of marker genes across annotated subclusters. d) Feature plots highlighting distinctive marker gene expression in WT vs. PLXNB2 ⁻/⁻ subclusters. e) Volcano plot of DEGs (adj. P < 0.05, log 2 FC > 1) with selected genes labeled. f) GO enrichment analysis of DEGs, grouped by biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Heatmap showing functional gene groups: WT organoids upregulated mature neuronal and synaptic genes, whereas PLXNB2 ⁻/⁻ organoids upregulated stromal/EMT-associated genes, indicating lineage instability and aberrant mesenchymal-like states. h) IPA network analysis revealed broad suppression of progenitor/neuronal regulatory pathways in KO organoids, with limited activation of developmental branching and stress-response regulators. i) Predicted upstream regulators of DEGs, including suppression of proliferation- and neurogenesis-associated TFs and activation of senescence and stress regulators. j) Transcriptome scoring against human cortical developmental signatures (Velmeshev et al., 2023) with WT organoid cells primarily aligning with 2 nd trimester signatures, whereas PLXNB2 ⁻/⁻ organoids also align with postnatal/adult signatures, indicating accelerated developmental age. k) Comparative IPA of PLXNB2 ⁻/⁻ vs. WT in D36 iNs and d42 organoids revealed convergent alterations in neuronal differentiation and brain morphology pathways, supporting both models for Plexin-B2-linked neurodevelopmental defects. l) Model: Plexin-B2 enforces a cortical mechanical barrier integrated with an epigenetic barrier to safeguard the timing of neuronal differentiation. Loss of Plexin-B2 lowers this barrier, leading to premature epigenetic reprogramming, accelerated neurogenesis, and lineage instability.

Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

Techniques: Expressing, Marker, Gene Expression, Labeling, Functional Assay, Activation Assay

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) IF showing loss of Plexin-B2 protein in PLXNB2 ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.

Article Snippet: Briefly, hESCs were transduced with Tet-pLKO-Puro-based lentiviral vectors expressing doxycycline (Dox)-inducible shRNAs against PLXNB2 (pLKO-Tet-On-PLXNB2-shRNA1 or -shRNA2; backbone Addgene #21915, shRNA1 Addgene #98399, shRNA2 Addgene #98400) or a non-targeting control (pLKO-Tet-On-shRNA-Ctrl).

Techniques: Two Tailed Test, Knock-Out, Expressing, Live Cell Imaging, Labeling

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) UMAP embedding of snRNA-seq data from D9 cells (n = 3 replicates per genotype). WT cells segregated into clusters enriched for radial glia (RG), neural progenitors (NPCs), and ESC-like states, whereas KO cells aligned with differentiated neuronal clusters. b) Feature plots showing expression of NPC and neuronal markers. c) Expression of representative marker genes across D9 subclusters. d) Volcano plot of differentially expressed genes (DEGs; PLXNB2 -/- vs. WT), with selected genes highlighted. e) Bubble plot of enriched pathways upregulated in D9 PLXNB2 ⁻/⁻ cells. f) ENRICHR GO enrichment analysis of DEGs for categories of biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Violin plots showing downregulation of actin cytoskeleton–associated genes in PLXNB2 -/- cells. h) Heatmap of DEGs grouped by functional categories, across three replicates per genotype. i) Ingenuity Pathway Analysis (IPA) network summary. Growth factor signaling pathways were broadly suppressed, while PTEN was activated in PLXNB2 ⁻/⁻ cells. j) Predicted upstream regulators (IPA) of DEGs in PLXNB2 ⁻/⁻ vs. WT cells. k) Developmental stage scoring against human cortex gene signatures (Velmeshev et al., 2023). D9 WT cells aligned with 2 nd -3 rd trimester profiles, whereas PLXNB2 ⁻/⁻ cells shifted toward postnatal signatures.

Article Snippet: Briefly, hESCs were transduced with Tet-pLKO-Puro-based lentiviral vectors expressing doxycycline (Dox)-inducible shRNAs against PLXNB2 (pLKO-Tet-On-PLXNB2-shRNA1 or -shRNA2; backbone Addgene #21915, shRNA1 Addgene #98399, shRNA2 Addgene #98400) or a non-targeting control (pLKO-Tet-On-shRNA-Ctrl).

Techniques: Expressing, Marker, Functional Assay, Protein-Protein interactions

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) Workflow for generating anti-Plexin-B2 (PB2) nanobodies (Nbs). Camelids were immunized with recombinant extracellular domain of human PB2 protein, followed by phage display to isolate high-affinity VHHs, which were fused to human Fc (hFc). b) Experimental design. VHH-Fc Nbs (10 μg/ml) were added one day before iN protocol. c) Representative images showing reduced cortical F-actin, increased DCX and TUJ1, and decreased SOX2 in D10 cells treated with two independent anti-PB2 Nbs compared with control or no Nb. d) Quantification of marker expression. Each dot represents the mean of a field of view. n = 5 cultures for each condition; one-way ANOVA with Dunnett’s multiple-comparison test. Bar graphs represent mean ± SEM.

Article Snippet: Briefly, hESCs were transduced with Tet-pLKO-Puro-based lentiviral vectors expressing doxycycline (Dox)-inducible shRNAs against PLXNB2 (pLKO-Tet-On-PLXNB2-shRNA1 or -shRNA2; backbone Addgene #21915, shRNA1 Addgene #98399, shRNA2 Addgene #98400) or a non-targeting control (pLKO-Tet-On-shRNA-Ctrl).

Techniques: Recombinant, Control, Marker, Expressing, Comparison

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) Standard forebrain and midbrain neuronal differentiation protocols. At D36, WT cells generated dense networks of TUJ1⁺ axon-bearing neurons, whereas PLXNB2 ⁻/⁻ cells displayed aberrant morphologies. b) Accelerated protocol. After passage at D9, cells were switched directly to maturation medium, bypassing the differentiation media step. By D18a, PLXNB2 ⁻/⁻ cells developed dense networks of TUJ1⁺ axon-bearing neurons, while WT cells retained progenitor-like morphology. c) IF comparison of neuronal markers and morphology in D36 WT (standard protocol) and D18a PLXNB2 ⁻/⁻ (accelerated protocol) cells. d) UMAP embedding of D18a PLXNB2⁻/⁻ and D36 WT iNs, showing segregation by genotype and forebrain vs. midbrain protocols. e) Feature plots showing shared neuronal markers across subclusters and genotypes. f) Transcriptional profiling revealed comparable expression of core neuronal/axonal markers between D36 WT and D18a PLXNB2 ⁻/⁻ cells, but lower expression of functional genes in the latter. g) Experimental timeline and IF images show co-culture of iNs with GFAP⁺ astrocyte lawns to promote maturation. h) Multi-electrode array (MEA) recordings. PLXNB2 ⁻/⁻ cells after maturation exhibited higher firing rates and synchrony index than WT cells (n = 6 cultures per condition; one-way ANOVA with Dunnett’s correction). Bar graphs represent mean ± SEM. i) Heatmap of epigenetic regulators shows convergent transcriptional shifts of D36 WT and D18a PLXNB2 ⁻/⁻ iNs relative to D9 WT cells. D9 PLXNB2 ⁻/⁻ cells already exhibited a similar shift, indicating accelerated epigenetic reprogramming. j) D9 PLXNB2 ⁻/⁻ cells showed elevated nuclear TET3 compared with D9 WT, reaching levels comparable to D36 WT. n = 5 fields from 2 independent experiments for each condition, nested one-way ANOVA with Tukey’s multiple-comparison test. k) D9 PLXNB2 ⁻/⁻ cells exhibited precocious expression of lamin A/C, similar to D36 WT and D18a PLXNB2 ⁻/⁻ iNs. l) Working model: Plexin-B2-mediated cortical tension act as a mechanical barrier alongside an epigenetic barrier to prevent precocious differentiation.

Article Snippet: Briefly, hESCs were transduced with Tet-pLKO-Puro-based lentiviral vectors expressing doxycycline (Dox)-inducible shRNAs against PLXNB2 (pLKO-Tet-On-PLXNB2-shRNA1 or -shRNA2; backbone Addgene #21915, shRNA1 Addgene #98399, shRNA2 Addgene #98400) or a non-targeting control (pLKO-Tet-On-shRNA-Ctrl).

Techniques: Generated, Comparison, Expressing, Functional Assay, Co-Culture Assay

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) IF of day 42 cerebral organoids shows broad Plexin-B2 expression in the ventricular zone (VZ; SOX2⁺) and cortical plate (CP), including FAM107A⁺ outer radial glia. b) IF of human fetal brain at 23 gestational weeks reveals broad Plexin-B2 expression in the SOX2⁺ germinal matrix and developing cortex, including FAM107A⁺ cells. c) Representative images and quantification of organoid diameters show reduced size in PLXNB2 ⁻/⁻ organoids (WT, n = 15; KO, n = 16). Bar graphs represent mean ± SEM; unpaired two-tailed Student’s t-test. d) Left, IF demonstrates loss of Plexin-B2 in d42 KO organoids. Right, Western blot confirms Plexin-B2 ablation, with β-actin as loading control. Quantification from n = 3 independent experiments. unpaired two-tailed Student’s t -test. e) Left, IF reveals disrupted architecture of KO organoids with shrinkage of SOX2 + VZ. Right, Western blot and heatmap show reduced SOX2 and increased TUJ1. n = 3 independent cultures per condition; unpaired two-tailed Student’s t-test. f) KO organoids exhibit expanded but disorganized DCX⁺ neuroblasts and reduced PAX6⁺ progenitors. g) Disrupted neuroepithelial organization in KO organoids, with diffuse β-catenin, N-cadherin, and reduced apical F-actin enrichment. h) WT organoids contain a dense apical ring of proliferating Ki67⁺/pH3⁺ cells, which was reduced and mislocalized in KO organoids. i) EdU pulse-chase assay design (30 min pulse, 24 h chase). KO organoids showed increased cell-cycle exit (i.e. fraction of Ki67⁻ cells among EdU⁺ cells). n = 6 fields from 3 independent organoids for each condition; unpaired two-tailed t-test. j) Model: Plexin-B2 maintains progenitor pool homeostasis by regulating the timing of neuronal differentiation. Loss of Plexin-B2 leads to premature cell-cycle exit, precocious neuronal differentiation, and progenitor depletion.

Article Snippet: Briefly, hESCs were transduced with Tet-pLKO-Puro-based lentiviral vectors expressing doxycycline (Dox)-inducible shRNAs against PLXNB2 (pLKO-Tet-On-PLXNB2-shRNA1 or -shRNA2; backbone Addgene #21915, shRNA1 Addgene #98399, shRNA2 Addgene #98400) or a non-targeting control (pLKO-Tet-On-shRNA-Ctrl).

Techniques: Expressing, Two Tailed Test, Western Blot, Control, Pulse Chase

Journal: bioRxiv

Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

doi: 10.1101/2025.09.19.677444

Figure Lengend Snippet: a) UMAP embedding of snRNA-seq profiles from day 42 cerebral organoids (n = 3 replicates per genotype). EN, excitatory neurons; Mes, mesenchymal-like; Epen, ependymal-like; SCP, Schwann cell precursor/neural crest-like. b) Stacked bar plots show loss of RG (sc0) and expansion of subplate-like (sc3) and maturing EN (sc6) populations in PLXNB2 ⁻/⁻ organoids, reflecting accelerated neurogenesis and lineage imbalance. c) Dot plot showing expression of marker genes across annotated subclusters. d) Feature plots highlighting distinctive marker gene expression in WT vs. PLXNB2 ⁻/⁻ subclusters. e) Volcano plot of DEGs (adj. P < 0.05, log 2 FC > 1) with selected genes labeled. f) GO enrichment analysis of DEGs, grouped by biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Heatmap showing functional gene groups: WT organoids upregulated mature neuronal and synaptic genes, whereas PLXNB2 ⁻/⁻ organoids upregulated stromal/EMT-associated genes, indicating lineage instability and aberrant mesenchymal-like states. h) IPA network analysis revealed broad suppression of progenitor/neuronal regulatory pathways in KO organoids, with limited activation of developmental branching and stress-response regulators. i) Predicted upstream regulators of DEGs, including suppression of proliferation- and neurogenesis-associated TFs and activation of senescence and stress regulators. j) Transcriptome scoring against human cortical developmental signatures (Velmeshev et al., 2023) with WT organoid cells primarily aligning with 2 nd trimester signatures, whereas PLXNB2 ⁻/⁻ organoids also align with postnatal/adult signatures, indicating accelerated developmental age. k) Comparative IPA of PLXNB2 ⁻/⁻ vs. WT in D36 iNs and d42 organoids revealed convergent alterations in neuronal differentiation and brain morphology pathways, supporting both models for Plexin-B2-linked neurodevelopmental defects. l) Model: Plexin-B2 enforces a cortical mechanical barrier integrated with an epigenetic barrier to safeguard the timing of neuronal differentiation. Loss of Plexin-B2 lowers this barrier, leading to premature epigenetic reprogramming, accelerated neurogenesis, and lineage instability.

Article Snippet: Briefly, hESCs were transduced with Tet-pLKO-Puro-based lentiviral vectors expressing doxycycline (Dox)-inducible shRNAs against PLXNB2 (pLKO-Tet-On-PLXNB2-shRNA1 or -shRNA2; backbone Addgene #21915, shRNA1 Addgene #98399, shRNA2 Addgene #98400) or a non-targeting control (pLKO-Tet-On-shRNA-Ctrl).

Techniques: Expressing, Marker, Gene Expression, Labeling, Functional Assay, Activation Assay

Journal: Nature Communications

Article Title: Computational ranking identifies Plexin-B2 in circulating tumor cell clustering with monocytes in breast cancer metastasis

doi: 10.1038/s41467-025-62862-z

Figure Lengend Snippet: a A schematic of an integrated ranking, Rscore, of proteins in breast tumors, cancer cells, and CTCs with tumor specificity and clinical association, using multiple MS proteomic databases The mathematical model of Rscore integrates individual ranks ( \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${r}_{i}$$\end{document} r i ) of each protein in (1) relative protein abundance, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${r}_{i}$$\end{document} r i (pc), in multiple datasets (patient tumors, CTCs, and cell lines), (2) significance changes, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${r}_{i}$$\end{document} r i (sc) in tumor specificity, including p-value, ratio or fold change, and absolute change, comparing TNBC voxels (laser capture microdissection) to normal adjacent tissues, and (3) clinical association, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${r}_{i}$$\end{document} r i (ca) including p value and hazard ratio, with OS and DMFS among multiple datasets. The significance of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${r}_{i}$$\end{document} r i is multiplied by its constant weight factor ( \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${c}_{i}$$\end{document} c i ) with the sum divided by n for an integrated Rscore and final top three candidates. Created in BioRender. Tong, F. (2025) https://BioRender.com/nea43wo . b Representative IHC images of PLXNB2 high TNBC tumor and PLXNB2 low normal breast tissue (adjacent to tumors) from a TNBC patient. c KM plot for OS of patients with all breast cancer in the Tang_2018 data set ( n = 108) via Kaplan-Meier plotter, separated by the best cut-off value of PLXNB2 protein expression (4) in primary tumors to define high vs. low within the expression range (0-11). P values were calculated via the Cox-Mantel (log-rank) test. d KM plot for DMFS of patients with ER − breast cancer, divided by median cut-off of PLXNB2 mRNA expression using data from GEO, EGA, and TCGA, n = 218. P values were calculated using a log-rank test. e Schematic depicting the patient blood sample workflow for CTC analysis on CellSearch. f Representative CellSearch images of a homotypic PLXNB2 + CTC-CTC (CD45 − CK + DAPI + ) cluster, a heterotypic PLXNB2 + CTC-WBC (CD45 + CK - DAPI + ) cluster, and a single PLXNB2 - CTC. Scale bar = 5 µm. g Portion (%) of PLXNB2 + CTCs in single CTCs in comparison with homotypic CTC clusters and heterotypic CTC-WBC clusters), respectively, analyzed via CellSearch as shown in ( f ), n = 41 patients. Data are presented as mean values +/- SD, P values reported are from two-sided unpaired t-tests unless specified. Source data are provided as a Source Data file.

Article Snippet: The following overexpression vectors were used: pLV- PLXNB2 - mRBD (Addgene #86240), pLV- PLXNB2-dVTDL (Addgene 86239), pLV- PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1( + ) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1 + /C- C-Terminal Flag-Tag (GeneScript #OHu01778D), PLXNB2 Untagged Construct (GeneScript #SC1625).

Techniques: Quantitative Proteomics, Laser Capture Microdissection, Expressing, Comparison

Journal: Nature Communications

Article Title: Computational ranking identifies Plexin-B2 in circulating tumor cell clustering with monocytes in breast cancer metastasis

doi: 10.1038/s41467-025-62862-z

Figure Lengend Snippet: a Schematic showing the experimental workflow of orthotopic implantation and analyses of lung metastases and CTCs. b , c Representative images ( b ) and weight quantification of PLXNB2 Con and KO tumors ( c ) from mice at 10 weeks, n = 8 mice/group. d , e Bioluminescence images (BLI) of mouse lungs ex vivo ( d ) and quantified lung metastasis ( e ) at 10 weeks, n = 8 mice/group. f L2G + CTC counts (single and clusters) detected in PLXNB2 Con and KO mouse blood at 10 weeks of spontaneous metastasis, n = 4 mice/group. g , h Representative images ( g ) and metastatic burden ( h ) in PLXNB2 Con and KO metastatic cells of mouse lungs with H&E staining, scale bar = 250 µm; experiments were repeated with the PB2 KO clone, n = 4 lungs/group. Yellow arrows point to the micro metastases in the lungs. i Schematic representing experimental workflow of dual color implantations of L2T + (red) or L2G + (green) MDA-MB-231 tumor cells with PLXNB2 control (ConT, ConG) or PLXNB2 KO (KOT, KOG); mice were sacrificed after 6 weeks for analyses, n = 4 mice/group. j Representative images of green (ConG/KOG) and red (ConT/KOT) MDA-MB-231 colonies in the lungs of mice, n = 4 mice/group. k Counts of L2T + or L2G + colonies in the lungs of mice after 6 weeks orthopedic, n = 4 mice/group. l Counts of dual color colonies with red and green tumor cells in the lungs, n = 4 lungs/group. m CTC clusters in red/green count as analyzed via flow cytometry in the mice bearing the PLXNB2 Control and KO tumors, n = 8 mice/group. n Top left: Schematic of orthotopic implantation of PLXNB2 Con and KO tumor cells into of NSG mice (200,000 cells/site). Bottom left: KM plot of the mice shows Supplementary survival (2 weeks) in the mice bearing Con vs. KO tumors. Right panels: Photos (top) and bar graphs (bottom) of relatively comparable tumor weight between Con (8-week) and KO groups (10-week), n = 5 mice/group. o – q Bar graphs of blood CTC clusters ( o ), cell cycle phases ( p ), and spontaneous lung metastasis ( q ) between the Con and KO tumors, n = 5 mice/group.Data are presented as mean values +/-SD, with P values reported from two-sided unpaired t-testsunless specified. Source data are provided as a Source Data file.

Article Snippet: The following overexpression vectors were used: pLV- PLXNB2 - mRBD (Addgene #86240), pLV- PLXNB2-dVTDL (Addgene 86239), pLV- PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1( + ) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1 + /C- C-Terminal Flag-Tag (GeneScript #OHu01778D), PLXNB2 Untagged Construct (GeneScript #SC1625).

Techniques: Ex Vivo, Staining, Control, Flow Cytometry

Journal: Nature Communications

Article Title: Computational ranking identifies Plexin-B2 in circulating tumor cell clustering with monocytes in breast cancer metastasis

doi: 10.1038/s41467-025-62862-z

Figure Lengend Snippet: a Flow panel showing the gating of PLXNB2 + and PLXNB2 - cells sorted from dissociated primary TN3 L2G + PDX cells for clustering in ( b , c ). b , c Representative images of clustering ( b ) and average cluster area and cluster count curves of sorted PLXNB2 high and low TN3 PDX cells ( c ); n = 5 technical replicates examined over 3 independent experiments. P-value was calculated using two-sided unpaired t-test. d , e Representative images ( d ) and cluster area ( e ) of MDA-MB-231 cells transfected with siRNA control (siCon), PLXNB2 SmartPool siRNA ( siPLXNB2 ), and single siRNA ( siPLXNB2-10 ), n = 5 technical replicates examined over 3 independent experiments. P-value was calculated using two-sided unpaired t-test. f , g Representative images ( f ) and cluster area ( g ) of MDA-MB-468 cells transfected with siCon, si PLXNB2 , and si PLXNB2 -10, n = 5 technical replicates examined over 3 independent experiments. P values were calculated using one-sided ANOVA. h Schematic of PLXNB2 domains: Extracellular (Ecto) domains include SEMA = SEMAphorin domain; IPT = Ig-like fold domain; and PSI = Plexin-SEMAphorin-integrin domain. Intracellular domains include RBD = Rho-binding domain; GAP = GTPase activating protein domain; and VTDL = PDZ-domain binding site (Rho-GEF binding). i Immunoblots of overexpressed PB2 mutants with either full-length (fl) or truncated (tr) depletions: mutated RBD (mRBD) tr, depleted Ecto domain (dECTO) fl and depleted VTDL (dVTDL) tr in MDA-MB-231 PB2 KO cells. j , k Representative images ( j ) and cluster area growth curves ( k ) of MDA-MB-231 PB2 KO clusters with overexpression of PLXNB2 full-length or mutants (mRBD, dECTO, or dVTDL); Con vs. KO + PLXNB2 p = 0.67, Con vs. KO1 p = 0.0002, Con vs. KO2 p = 1.43e-6, KO + PLXNB2 vs. KO+mRBD p = 0.04, KO + PLXNB2 vs. KO+dECTO p = 1.69e-6, KO + PB2 vs. KO+dVTDL p = 0.005, KO + PLXNB2 vs. KO1 p = 0.0002, n = 5 technical replicates examined over 3 independent experiments. P values were calculated using one-sided ANOVA. l – o Bioluminescence images ( l , n ) and quantified BLI signals ( m , o ) of dissected lungs ex vivo after transfections with siCon, siPLXNB2 ( l ), or si PLXNB2 -11 ( n ), n = 4 mice/group ( l , m ) and n = 3 mice/group ( n , o ). P-value between two groups was calculated using two-sided unpaired t-test. Data are presented as mean values ± SD. Source data are provided as a Source Data file.

Article Snippet: The following overexpression vectors were used: pLV- PLXNB2 - mRBD (Addgene #86240), pLV- PLXNB2-dVTDL (Addgene 86239), pLV- PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1( + ) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1 + /C- C-Terminal Flag-Tag (GeneScript #OHu01778D), PLXNB2 Untagged Construct (GeneScript #SC1625).

Techniques: Transfection, Control, Binding Assay, Western Blot, Over Expression, Ex Vivo

Journal: Nature Communications

Article Title: Computational ranking identifies Plexin-B2 in circulating tumor cell clustering with monocytes in breast cancer metastasis

doi: 10.1038/s41467-025-62862-z

Figure Lengend Snippet: a Schematic of PLXNB2-SEMA4C intercellular interactions in homotypic tumor cell clustering between two cancer cells. b Immunoblots of PLXNB2 (PB2) and SEMA4C expression in different breast cancer cell lines and PDX models using antibodies that are specific to detect both human and mouse isoforms. c Immunoblots of SEMA4C, CDC42, and PLXNB2 in the protein complex immunoprecipitated by anti-PLXNB2 antibody compared to IgG. d Immunoblot images showing reduced SEMA4C levels after SEMA4C KD in MDA-MB-231 tumor cells (left) and depleted PLXNB2 in PLXNB2 KO1 and KO2 cells (right). e Schematic illustration and immunoblotting of MDA-MB-231 control and PLXNB2 -KO cells transfected with siRNA control or siSEMA4C knockdown, followed by tumor cell clustering assessment in suspension. f , g Representative images ( f ) and average cluster area/size curves ( g ) of MDA-MB-231 control (Con) and PB2 KO (KO) cells transfected with control siRNA (siCon) or SEMA4C siRNAs ( si4C ) for KD, measured by IncuCyte, n = 5 technical replicates examined over 5 independent experiments. For cluster size (area) comparisons with the group of Con+ siCon , Student’s t test p = 0.033 for Con+ si4C , p = 0.021 for KO+ si4C , and p = 0.016 for KO+ siCon . For the cluster number comparisons with the Control group, p < 0.001 for all three pairs above. P value were calculated using one-sided ANOVA. h Principal component analysis clusters of MDA-MB-231 single cells, siCon clusters, and si PLXNB2 clusters analyzed from global proteomics analysis with n = 3 technical replicates/ group over three independent experiments. i Heat map of differentially expressed proteins from global proteomics analysis of siCon single cells (blue), siCon clusters (green), and si PLXNB2 clusters (red), with n = 3 technical replicates/ group over three independent experiments. j Gene ontology biological processes analysis of significantly up-regulated and down-regulated proteins in PLXNB2 control vs. PLXNB2 KD clusters in breast cancer cells analyzed by mass spectrometry. Data are presented as mean values ± SD. P values were calculated using one-sided ANOVA. Source data are provided as a Source Data file.

Article Snippet: The following overexpression vectors were used: pLV- PLXNB2 - mRBD (Addgene #86240), pLV- PLXNB2-dVTDL (Addgene 86239), pLV- PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1( + ) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1 + /C- C-Terminal Flag-Tag (GeneScript #OHu01778D), PLXNB2 Untagged Construct (GeneScript #SC1625).

Techniques: Western Blot, Expressing, Immunoprecipitation, Control, Transfection, Knockdown, Suspension, Mass Spectrometry

Journal: Nature Communications

Article Title: Computational ranking identifies Plexin-B2 in circulating tumor cell clustering with monocytes in breast cancer metastasis

doi: 10.1038/s41467-025-62862-z

Figure Lengend Snippet: a Schematic of the interactions between breast cancer cell PLXNB2 and monocyte SEMA4A for heterotypic cluster formation. b Representative images of heterotypic clusters of L2G + MDA-MB-231 control or PLXNB2 KO cells with WBCs from breast cancer patients (Pt). Top: fluorescent images with WBCs from Pt 396 (minimal Cytotox red-stained dead cells). Bottom: brightfield images with WBCs from Pt 431. An average of 13581 and 11376 WBCs is associated with Con and KO clusters, respectively. c Heterotypic cluster area curves as shown in ( b ) ( n = 5 replicates examined over 4 individual experiments). P-value was calculated using two-sided unpaired t-test. d SEMA4A expression on granulocytes, monocytes, and lymphocytes from four patients with advanced breast cancer. P-values were calculated using one-sided ANOVA. e Percent of heterotypic CTC-WBC clusters vs. WBC clusters that express both PB2 and SEMA4A, n = 4 patient samples. P-value was calculated using two-sided unpaired t-test. f , g Immunoblots of SEMA4A ( f ) and CDC42 ( g ) with cell lysates immunoprecipitated with anti-PlexinB2 (αPB2) or IgG isotype. h , i Representative images ( h ) and cluster area curves ( i ) of heterotypic clustering of MDA-MB-231 cells (green) and THP1 monocytes (yellow) mixed at a 1:4 ratio, n = 3 technical replicates examined over 3 individual experiments. P-value was calculated using two-sided unpaired t-test. j , k Representative images ( j ) and cluster size curves ( k ) of heterotypic clustering with L2G + TN1 PDX tumor cells (green, sorted by PLXNB2 high and low) and THP1 (yellow), n = 3 technical replicates examined over 3 individual experiments. P-value was calculated using two-sided unpaired t-test. l-m) Representative images ( l ) and cluster size curves ( m ) of MDA-MB-231 Con or KO cells clustering with THP1 (transfected with siCon or siSEMA4A ), n = 3 technical replicates examined over 3 individual experiments. P values were calculated using one-sided ANOVA.n) BLI images of NSG mice after tail vein injection of pre-clustered MDA-MB-231 cells alone ( PLXNB2 Con or KO), and with THP1 cells ( PLXNB2 Con/THP1, KO/THP1), n = 3 mice/group. P values were calculated using one-sided ANOVA. o BLI flux of lungs, n = 3 mice/group at each time point. Data are presented as mean values ± SD. Source data are provided as a Source Data file.

Article Snippet: The following overexpression vectors were used: pLV- PLXNB2 - mRBD (Addgene #86240), pLV- PLXNB2-dVTDL (Addgene 86239), pLV- PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1( + ) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1 + /C- C-Terminal Flag-Tag (GeneScript #OHu01778D), PLXNB2 Untagged Construct (GeneScript #SC1625).

Techniques: Control, Staining, Expressing, Western Blot, Immunoprecipitation, Transfection, Injection

Journal: Nature Communications

Article Title: Computational ranking identifies Plexin-B2 in circulating tumor cell clustering with monocytes in breast cancer metastasis

doi: 10.1038/s41467-025-62862-z

Figure Lengend Snippet: a , b Representative images at 6 h clustering ( a ) and quantification ( b ) of 4T1 cells transfected with siCon and siPlxnb2 during co-clustering with mouse white blood cells over 6 h; n = 5 technical replicates examined over 3 individual experiments, p = 0.008. c Schematic and quantification of % of heterotypic mouse 4T1 CTC clusters with monocytes at 6 h after tail vein injection of the tumor cells transfected with siRNA control (Con) and si Plxnb2 (>80% knockdown efficiencies by flow). 5 × 10 5 4T1 tumor cells were injected into Balb-c mice via the tail vein and cardiac blood was collected at 6 h for CTC analysis via flow cytometry ( n = 5 mice/group). d – i Schematic of orthotopic 4T1 breast tumor implantations (1.5 × 10 6 cells) at the L4/R4 mammary fat pads and following metastasis and CTC analyses ( d ), representative photos of 4T1 tumors (Control and Plxnb2 KO) and ex vivo lung bioluminescence images on Day 9 ( e ), and quantified tumor weight and volume ( f ), lung metastasis (total flux of bioluminescence) ( g ) and CTCs, including single CTCs in live blood cells ( h ) as well as 4T1-WBC heterotypic clusters and CTC-myeloid clusters ( i ) among all white blood cells (WBCs), shown as # of events in 10,000 WBCs, n = 5 mice/group. Tumor burden includes both L4/R4 tumors in each mouse and is used to normalize lung metastasis signals in ( g ). Data are presented as mean values +/-SD, with P values reported from two-sided unpaired t-tests. Source data are provided as a Source Data file.

Article Snippet: The following overexpression vectors were used: pLV- PLXNB2 - mRBD (Addgene #86240), pLV- PLXNB2-dVTDL (Addgene 86239), pLV- PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1( + ) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1 + /C- C-Terminal Flag-Tag (GeneScript #OHu01778D), PLXNB2 Untagged Construct (GeneScript #SC1625).

Techniques: Transfection, Injection, Control, Knockdown, Flow Cytometry, Ex Vivo